Skip to content

Assignment Of Zebrafish Genetic Linkage Groups To Chromosomes

Abstract

In this report the zebrafish genetic linkage groups are assigned to specific chromosomes using fluorescence in situ hybridization (FISH) with BAC probes containing genes mapped to each linkage group (LG). Chromosomes were identified using a combination of relative size and arm ratios. The largest genetic maps generally corresponded to the largest chromosomes, but genetic recombination tended to be elevated in the smaller chromosomes and near telomeres. Large insert clones containing genes near telomeres often hybridized to telomeres of multiple chromosome pairs, suggesting the presence of shared subtelomeric repetitive DNAs near telomeres. Evidence from comparative gene mapping in medaka, zebrafish, pufferfish, and humans suggests that the linkage groups of these species have the content of duplicate proto-chromosomes. However, these duplicate linkage groups are not associated with chromosomes of similar size or morphology. This suggests that considerable chromosome restructuring occurred subsequent to the genome duplication in teleosts.

© 2006 S. Karger AG, Basel


References

  1. Amores A, Postlethwait JH: Banded chromosomes and the zebrafish karyotype. Meth Cell Biol 60:323–338 (1999).
  2. Amores A, Force A, et al: Zebrafish hox clusters and vertebrate genome evolution. Science 282:1711–1714 (1998).
  3. Barbazuk WB, Korf I, Kadavi C, Heyen J, Tate S, Wun E, Bedell JA, McPherson JD, Johnson SL: The syntenic relationship of the zebrafish and human genomes. Genome Res 10:1351–1358 (2000).
  4. Curwen V, Eyras E, Andrews TD, Clarke L, Mongin E, Searle SM, Clamp M: The Ensembl automatic gene annotation system. Genome Res 14:942–950 (2004).
  5. Daga RR, Thode G, Amores A: Chromosome complement, C-banding, Ag-NOR and replication banding in the zebrafish Danio rerio. Chromosome Res 4:29–32 (1996).
  6. Dooley K, Zon LI: Zebrafish: a model system for the study of human disease. Curr Opin Genet Dev 10:252–256 (2000).
  7. Geisler R, Rauch GJ, et al: A radiation hybrid map for the zebrafish genome. Nat Genet 23:86–89 (1999).
  8. Gornung E, Gabrielli I, Cataudella S, Sola L: CMA3-banding pattern and fluorescence in situ hybridization with 18S rRNA genes in zebrafish chromosomes. Chromosome Res 5:40–46 (1997).
  9. Grunwald DJ, Eisen JS: Timeline: Headwaters of the zebrafish; emergence of a new model vertebrate. Nat Rev Genet 3:717–724 (2002).
  10. Huriede N, Fisher D, et al: The LN54 radiation hybrid map of zebrafish expressed sequences. Genome Res 11:2127–2132 (2001).
  11. Jaillon O, Aury JM, et al: Genome duplication in the teleost fish Tetraodon nigroviridis reveals the early vertebrate proto-karyotype. Nature 431:946–957 (2004).
  12. Johnson SL, Africa D, Horne S, Postlethwait J: Half-tetrad analysis in zebrafish: mapping the ros mutation and the centromere of linkage group I. Genetics 139:1727–1735 (1995).
  13. Johnson SL, Gates MA, Johnson M, Talbot WS, Horne S, Baik K, Rude S, Wong JR, Postlethwait J: Centromere-linkage analysis and consolidation of the zebrafish genetic map. Genetics 142:1277–1288 (1996).
  14. Kaufman EJ, Gestl EE, Kim DJ, Walker C, Hite JM, Yan G, Rogan P, Johnson SL, Cheng KC: Microsatellite-centromere mapping in the zebrafish (Danio rerio). Genomics 30:337–341 (1995).
  15. Kong A, Gudbjartsson DF, et al: A high-resolution recombination map of the human genome. Nat Genet 31:241–247 (2002).
  16. Mohideen MA, Moore JL, Cheng KC: Centromere-linked microsatellite markers for linkage groups 3, 4, 6, 7, 13, and 20 of zebrafish (Danio rerio). Genomics 67:102–106 (2000).
  17. Naruse K, Tanaka M, Mita K, Shima A, Postlethwait J, Mitani H: A medaka gene map: the trace of ancestral vertebrate proto-chromosomes revealed by comparative gene mapping. Genome Res 14:820–824 (2004).
  18. Phillips RB, Reed KM: Localization of repetitive DNAs to zebrafish chromosomes using multi-color fluorescence in situ hybridization. Chromosome Res 8:27–35 (2000).
  19. Postlethwait J, Johnson S, et al: A genetic linkage map for the zebrafish. Science 264:699–703 (1994).
  20. Postlethwait J, Yan Y-L, et al: Vertebrate genome evolution and the zebrafish map. Nat Genet 18:345–349 (1998).
  21. Postlethwait JH, Woods IG, Ngo-Hazelett P, Yan YL, Kelly PD, Chu F, Huang H, Hill-Force A, Talbot WS: Zebrafish comparative genomics and the origins of vertebrate chromosomes. Genome Res 10:1890–1902 (2000).

Abstract

The legume genus, Lupinus, has many notable properties that make it interesting from a scientific perspective, including its basal position in the evolution of Papilionoid legumes. As the most economically important legume species, L. angustifolius L. (narrow-leafed lupin) has been subjected to much genetic analysis including linkage mapping and genomic library development. Cytogenetic analysis has been hindered by the large number of small morphologically uniform chromosomes (2n = 40). Here, we present a significant advance: the development of chromosome-specific cytogenetic markers and assignment of the first genetic linkage groups (LGs) to chromosomal maps of L. angustifolius using the bacterial artificial chromosome (BAC)–fluorescence in situ hybridization approach. Twelve clones produced single-locus signals that “landed” on 7 different chromosomes. Based on BAC-end sequences of those clones, genetic markers were generated. Eight clones localized on 3 chromosomes, allowed these chromosomes to be assigned to 3 LGs. An additional single-locus clone may be useful to combine an unassigned group (Cluster-2) with main LGs. This work provides a strong foundation for future identification of all chromosomes with specific markers and for complete integration of narrow-leafed lupin LGs. This resource will greatly facilitate the chromosome assignment and ordering of sequence contigs in sequencing the L. angustifolius genome.

BAC-FISH, BEST marker, chromosome marker, linkage map, Lupinus angustifolius

Lupinus species belong to the legume family (Fabaceae), one of the 3 largest Angiosperm families, and have features typical of the family, most notably the ability to fix nitrogen symbiotically with bacteria known as rhizobia (e.g., Rhizobium or Bradyrhizobium) (Howieson et al. 1998). Four Lupinus species are grain crops, with the most important being L. angustifolius L. (narrow-leafed lupin). Various Old and New World lupins have been the subject of cytogenetic analyses including chromosome counting and measuring (Naganowska and Ładoń 2000; Maciel and Schifino-Wittmann 2002; Conterato and Schifino-Wittmann 2006) and genome size estimation (Naganowska et al. 2003; Naganowska et al. 2006). Fluorescence in situ hybridization (FISH) has been applied to many plant genomes as a useful tool for chromosome analysis (Kulikova et al. 2001; Pedrosa et al. 2002, 2003; Pagel et al. 2004; Jiang and Gill 2006). Ribosomal DNA (rDNA) FISH probes have been used in a number of lupin species (Naganowska and Zielińska 2002; Hajdera et al. 2003; Naganowska and Zielinska 2004; Kong et al. 2009). Nuclear genome of L. angustifolius is partitioned into many chromosomes (2n = 40), which are small and morphologically uniform, making cytogenetic analysis and identification challenging (Kaczmarek et al. 2009). FISH analysis using rDNA probes has proved unsuccessful in identifying all L. angustifolius chromosomes.

One solution may be to conduct FISH using bacterial artificial chromosome (BAC) clones as probes (a procedure known as BAC-FISH) that enables physical localization of relatively large fragments of nuclear DNA directly on chromosomes. BAC probes can serve various purposes, such as obtaining chromosome-specific landmarks and assignment of genetic linkage groups (LGs) to corresponding chromosomes (Islam-Faridi et al. 2002). However, BAC clones of L. angustifolius have not so far been used for LG and chromosome assignment.

Over the last decade, intensive efforts have been made to construct lupin genetic maps. For L. angustifolius, maps were established based on microsatellite fragment length polymorphism (MFLP) (Boersma et al. 2005) and gene-based markers (Nelson et al. 2006). Recently, Nelson et al. (2010) constructed a consensus genetic map consisting of >1100 loci based on combined data from the previous 2 maps. This new reference map for L. angustifolius comprises 20 main LGs (narrow leafed lupins [NLLs]) and 3 small unlinked groups (Clusters), which together with the BAC library of L. angustifolius genome constructed by Kasprzak et al. (2006) provides the resources required for detailed integrative genome analysis of narrow-leafed lupin using the BAC-FISH approach. In this study, we established a set of BAC-based cytogenetic landmarks that allowed unambiguous identification of 7 L. angustifolius chromosomes. Additionally, these BACs were used for generation of genetic markers to find LGs corresponding to particular chromosome pairs.

Material and Methods

Seeds of L. angustifolius cv. Sonet were obtained from the Polish Lupinus Gene Bank in the Breeding Station Wiatrowo (Poznan Plant Breeders Ltd, Poland). Seeds of mapping population consisting of 89 F8 recombinant inbred lines (RILs) of a cross between a breeding line 83A:476 and a wild-type P27255 (Boersma et al. 2005) were kindly provided by Huaan Yang, Department of Agriculture and Food, Western Australia.

BAC clones were originated from the library of L. angustifolius cv. Sonet nuclear genome (Kasprzak et al. 2006). Clones used for LG/chromosome assignment analysis are listed in Supplementary Table 1.

Selection of BAC Clones

Hybridization probes for BAC library screening were prepared based on DNA sequences originated from genetic markers closely linked to disease resistance genes: AntjM1 and AntjM2 markers linked to anthracnose resistance gene, Lanr-1 (Yang et al. 2004; You et al. 2005), Ph258M2, a marker linked to Phomopsis stem blight resistance gene, Phr-1 (Yang et al. 2002), and RustM1, a marker linked to lupin rust resistance trait (Sweetingham et al. 2005). As the markers were developed by MFLP technique (Yang et al. 2001), they contained microsatellite motifs: (TTG)6 in AntjM1, (AAC)6 in Ph258M2, and (GA)7 in RustM1. Additionally, the AntjM2 marker encoded the nucleotide binding site sequence GLPLAL. Subsequently, the specific primer pairs were designed to avoid incorporation of these repetitive motives into probe sequences: AntjM1F:TGGTTTGTGCATTAGCATTTG, AntjM1R:CAACACATATGGTAAGAATCTAAG, AntjM2F:CTAAATTTCCTGGAACAAAAA, AntjM2R:AAACTCTATTTACTCATGTGTCAA, Ph258M2F:GTTCAATTCTGGTACTGAAC, Ph258-M2R:GTAGTGACTGAAGAAACTTACAC, RustM1F:TAACATTCCTACCTTCTT, and RustM1R:AACACTAGTGCTTCAAAAA.

In addition, one hybridization probe was constructed on the basis of the symbiotic receptor kinase gene sequence fragment (SymRK), which is one of the key genes of the common signaling cascade involved in plant–microbial symbiotic associations, such as arbuscular mycorrhiza and nodulation (Endre et al. 2002; Stracke et al. 2002) The primer pair used was as follows: SRK-F1:CTGCAACTGAAGGGTTTGAGAGCA and SRK-R5: CTTAACCTAACCTTGGTCAAGGC.

All probes were amplified by polymerase chain reaction (PCR) using L. angustifolius cv. Sonet genomic DNA as a template. The PCR products were purified by QIAquick PCR Purification Kit (Qiagen, Hilden, Germany) and radiolabeled by random priming HexaLabel DNA Labeling Kit (Fermentas, Ontario, Canada) with the presence of 50 μCi [α-32P]-deoxycytidine 5′-triphosphate.

BAC Library Screening

High-density DNA macroarrays on Hybond-N+ 22.2 × 22.2 cm nylon filters (Kasprzak et al. 2006) were hybridized with probes for 16 h at 65 °C in a hybridization solution composed of 5× standard saline citrate (SSC) (0.75 M NaCl, 0.075 M sodium citrate), 5× Denhardt's solution (0.1% w/v Ficoll-400, 0.1% w/v polyvinylpyrrolidone, 0.1% w/v bovine serum albumin [BSA]), and 0.5% w/v sodium dodecyl sulfate (SDS). Three high stringency washes in 0.1× SSC and 0.1% SDS at 65 °C for 30 min were conducted. For RustM1 and Ph258M2 probes, the temperature of washes was reduced to 60 °C. After hybridization, macroarrays were exposed for 24–48 h to BAS-MS 2340 imaging plates (Fujifilm) and scanned using a FLA-5100 phosphoimager (Fujifilm). Verification of clones that gave positive hybridization signals was performed by PCR using the same sets of primers that were applied for probe amplification.

BAC DNA Isolation

BAC DNA was isolated from single Esherichia coli colonies by a miniprep method using QIAprep Spin Miniprep Kit (Qiagen) according to the protocol of Farrar and Donnison (2007) and digested using restriction enzyme NotI (Roche Diagnostics, Basel, Switzerland). The quality and size of inserts were estimated by pulsed field gel electrophoresis (PFGE). To estimate insert size, Lambda ladder PFG marker (New England Biolabs, Ipswich, MA) and O′GeneRuler 1 kb Plus DNA Ladder, ready-to-use (Fermentas) were used as fragment size markers.

Mitotic Chromosome Preparation

Chromosome preparations were made from the root meristem tissue according to the protocol for mitotic chromosome squashes provided by Jenkins and Hasterok (2007) with minor modifications resulting from specificity of the narrow-leafed lupin material. To synchronize and accelerate germination, the seeds were aired in tap water at 25 °C overnight prior to transfer on moistened filter paper in petri dishes at 25 °C. Seedlings with 1.5–2.0 cm root length were treated in chilled tap water (2–3 °C) for 24 h to accumulate cells at metaphase. Excised roots were drained and immediately fixed in freshly made 3:1 ethanol:glacial acetic acid mixture and stored at −20 °C until use. Roots were digested in enzyme solution comprising 40% (v/v) pectinase (Sigma, St. Louis, MO), 3% (w/v) cellulase (Sigma), and 1.5% (w/v) cellulase “Onozuka R-10” (Serva, Heidelberg, Germany) for 3–4 h at 37 °C. Chromosome preparations were made from dissected meristematic tissue on alcohol-cleaned slides in one drop of 60% acetic acid and frozen. Preparations were postfixed in 3:1 ethanol:glacial acetic acid, dehydrated in 99.8% ethanol for 20 min, and then air-dried. The slides were quality-controlled under a phase-contrast microscope (BX41, Olympus) and used for FISH.

Fluorescence In Situ Hybridization

FISH was carried out according to the protocol of Jenkins and Hasterok (2007) with minor modifications. BAC DNA was labeled with digoxygenin-11-dUTP and/or tetramethyl-rhodamine-5-dUTP (Roche Diagnostics) by nick translation reaction as described by Jenkins and Hasterok (2007)